Делан грунтовка: Продукция Делан



Продукция Делан

Защитные антикоррозионные покрытия

Предназначенных для проведения переизоляции в трассовых условиях при ремонте труб, нефте- газопродуктопроводов диаметром до 1420 мм включительно, с температурой транспортируемого продукта не выше 50 ºС.
Требуемый уровень показателей к грунтовки «ДЕКОМ-ИНГ».


Мастика «ДЕКОМ» предназначена в качестве защитного слоя (обертки) в конструкции покрытия на основе мастики «ДЕКОМ-АЭРОГАЗ» ТУ 5775-016-32989231-2013 при переизоляции труб, запорной армактуры, соединительных деталей и монтажных узлов газо- и нефтепродуктопроводов диаметром до 1420 мм включительно, с температурой транспортируемого продукта не выше плюс 35 ºС.


Мастика «ДЕКОМ-АЭРОГАЗ» предназначена для защиты от коррозии при проведении в трассовых условиях капитального ремонта изоляционного покрытия (переизоляции) труб, запорной арматуры и соединительных деталей газо- и нефте- продуктопроводов диаметром до 1420 мм включительно, с температурой транспортируемого продукта не выше плюс 35 ºС.
Требуемый уровень показателей к мастике «ДЕКОМ-АЭРОГАЗ»


Предназначен для защиты от коррозии при проведении в трассовых условиях капитального ремонта изоляционного покрытия (переизоляции) труб газо- и нефте- продуктопроводов диаметром до 1420 мм включительно, с температурой  транспортируемого продукта не выше 50 ºС.


Полимерно-битумная лента «ЛИТКОР-НЕФТЬ» предназначена для антикоррозионной защиты наружной поверхности стальных магистральных нефтепроводов и нефтепродуктопроводов диаметром до 1220 мм включительно и отводов от них, трубопроводов перекачивающих и насосных станций, нефтебаз при температуре  транспортируемого продукта  не выше 40 ºС.


Мастика «ДЕКОМ-ГАЗ» предназначена для изготовления:

обертки термостойкой радиационно-модифицированной мастичной

материала термостойкого рулонного армированного мастичного «ДЕКОМ-РАМ»

мастики изоляционной битумно-полимерной


Предназначена для проведения переизоляции в трассовых условиях при ремонте труб, соединительный деталей и монтажных узлов газо-, нефте- продуктопроводов диаметром до 1420 мм включительно, с температурой транспортируемого продукта не выше 50 ºС.


Предназначена в конструкции покрытия, в  качестве обертки, при проведении в трассовых условиях капитального ремонта изоляционного покрытия (переизоляции) труб газонефтепродуктопроводов диаметром до 1020 мм включительно, с температурой транспортируемого продукта не выше плюс 35 °С.


Предназначен для защиты от коррозии при проведении в трассовых условиях капитального ремонта изоляционного покрытия (переизоляции) труб газонефтепродуктопроводов диаметром до 1420мм включительно с температурой транспортируемого продукта не выше плюс 35 ºС.
Требуемый уровень показателей материала «РАМ».


Предназначенна для получения противокоррозионных армированных покрытий при проведении в трассовых условиях капитального ремонта (переизоляции) газо-, нефте, продуктопроводов диаметром до 1420 мм включительно с температурой транспортируемого продукта не выше плюс 35 ºС.


Предназначена для применения в конструкциях битумно-полимерных противокоррозионных по-крытий для проведения в трассовых условиях капитального ремонта (переизоляции) труб, соединительный деталей и монтажных узлов газо-, нефте- продуктопроводов диаметром до 1420 мм включительно, с температурой транспортируемого продукта не выше плюс 35 ºС.


Полимерно-битумная лента «ДЕМАР» предназначена для создания защитной гидроизоляционной оболочки предотвращающей проникновение грунтовых вод к  поверхности тепловой изоляции при нанесении теплоизоляционного покрытия в трассовых условиях на стальных магистральных нефтепроводов и нефтепродуктопроводов диаметром до 1420 мм включительно и отводов от них, трубопроводов перекачивающих и насосных станций, нефтебаз.


Мастика битумно-полимерная изоляционная «ТРАНСКОР» предназначена для антикоррозионной защиты наружной поверхности стальных магистральных нефтепроводов,  нефтепродуктопроводов и водоводов диа-метром до 1220 мм включительно и отводов от них, трубопроводов перекачивающих и насосных станций, нефтебаз при температуре  транспортируемого продукта  не выше 40 ºС.
Мастика выпускается двух типов: «ТРАНСКОР-Т» и «ТРАНСКОР-Р».


Комбинированная система покрытия на основе битумно-полимерной мастики  «ТРАНСКОР-Т» предназначена для антикоррозионной защиты наружной поверхности стальных магистральных нефтепроводов,  нефтепродуктопроводов и водоводов диаметром до 1220 мм включительно и отводов от них, трубопроводов перекачивающих и насосных станций, нефтебаз при температуре  транспортируемого продукта не выше 40 ºС.


Грунтовка «ТРАНСКОР» предназначена для нанесения на наружную поверхность  стальных магистральных нефтепроводов, нефте-продуктопроводов и водоводов  диаметром до 1220 мм включительно в конструкциях защитных покрытий на основе битумно-полимерных мастичных или рулонных материалов. Температура транспортируемого продукта не выше 40 °С.


Предназначена в конструкции покрытия, в  качестве обертки, при проведении в трассовых условиях капитального ремонта изоляционного покрытия (переизоляции)  труб газонефтепродуктопроводов диаметром до 530 мм включительно с температурой транспортируемого продукта не выше плюс 35 ºС.


Оборудование и материалы для электрохимической защиты

КГСГ «Делан» предназначены для удержания стойки КИП в вертикальном положении в болотистой местности, работающие в атмосферных условиях при рабочих температурах от минус 60ºС до плюс 60ºС.
КГСГ «Делан» выпускаются для стоек тип 1 (треугольного сечения) и тип 2 (квадратного сечения).


БСЗ «Делан» предназначен для распределения и регулирования электрического тока в системе электрохимической защиты трубопроводов, в том числе, для  совместной защиты нескольких сооружений подземных коммуникаций, расположенных в непосредственной близости друг от друга, от одного преобразователя.


Контрольно-измерительные пункты параметров электрохимической защиты трубопроводов КП ЭХЗ (СТЕКОН), предназначенны для контроля (регулировки) параметров электрохимической защиты (ЭХЗ) и обозначения трасс подземных и наземных трубопроводов (газопроводов), работающие в атмосферных условиях при рабочих температурах от минус 60ºС до плюс 60ºС.


Предназначены для защиты трубопроводов, емкостей, резервуаров от вредного влияния блуждающих токов, снижения потерь токов катодной защиты, предотвращения проявлений гальванической и щелевой коррозии, а также защиты антикоррозионных защитных покрытий от механических повреждений. Изделия монтируются на опорах трубопроводов различных типов во всех климатических зонах, для температуры окружающей среды от минус 60 ºС до плюс 60 ºС. Теплостойкость изделий до 110 ºС.


ИПЗ «Делан» предназначены для информации и предупреждения о прохождении трасс, охранных зон трубопроводов, кабелей, о пере-сечении с иными наземными и подземными коммуникациями и т.д.


ПИП «Делан» предназначен для обозначения на местности пункта измерения электрохимического потенциала «сооружение-земля» при помощи переносного или стационарного электрода сравнения в период обмерзания грунта. Температура эксплуатации от минус 60 ºС до плюс 60 ºС.


Футеровочная рейка «Делан» предназначена для защиты изоляционного покрытия газопровода, наружным диаметром 325 мм — 1420 мм, от повреждений в результате контакта со средствами балластировки и при протаскивании, укладываемых в обводненной и заболоченной местности при строительстве, ремонте и  реконструкции, а также на подводных переходах.


АЗПГ «ДЕЛАН» предназначен для использования в качестве малорастворимых протяженных гибких анодных заземлений с подповерхностным и глубинным расположением в установках катодной защиты от коррозии подземных металлических сооружений.


Блок контроля токов анодных заземлителей «КАЗ-ДЕЛАН» предназначен для контроля работы анодных заземлителей и протекторов путём измерения тока.


Термостойкая лента «ДЕКОМ-КОР» применяется в качестве обертки, в конструкциях покрытий.


Грунтовка термостойкая битумно-полимерная Деком-ИНГ, защита от коррозии


  • Безналичный расчет


  • Самовывоз
  • Собственная логистика
  • Транспортная компания

ТУ 2313-030-32989231-2015

Грунтовка термостойкая битумно-полимерная «ДЕКОМ-ИНГ» содержащая ингибирующую КРН композицию, применяется в следую-щих конструкциях битумно-полимерных антикоррозионных покрытий:

• на основе термостойкого рулонного армированного мастичного материала «ДЕКОМ-РАМ» ТУ 5774-015-32989231-2013;

• на основе мастики битумно-полимерной изоляционной «ТРАНСКОР-ГАЗ» ТУ 5775-004-32989231-2015;

• на основе рулонного мастичного армированного материала «РАМ» ТУ 5774-008-32989231-2016.

Предназначенных для проведения переизоляции в трассовых условиях при ремонте труб, нефте- газопродуктопроводов диаметром до 1420 мм включительно, с температурой транспортируемого продукта не выше 50 ºС.

Требуемый уровень показателей к грунтовки «ДЕКОМ-ИНГ».

Наименование показателя и единицы измерения


Метод контроля по ТУ


Внешний вид

Цвет — черный. Отсутствие комков, сгустков

п. 5.2


Вязкость по ВЗ-4, при температуре (23+2)  ºС, сек


п. 5.3


Массовая доля нелетучих веществ, %, не менее


п. 5.4


*Адгезионная прочность конструкции покрытия (сталь – грунтовка — мастика, армированная стеклосеткой — защитная обертка) методом отслаивания (под углом 900, v=100 мм/мин), Н/см, не менее:


п. 5.5

при температуре (23±2) ºС


при температуре (50±2) ºС



*Адгезионная стойкость конструкции покрытия (сталь – грунтовка — мастика, армированная стеклосеткой — защитная обертка) при сдвиге

(v=50 мм/мин), МПа, не менее:


п. 5.6

при температуре (23±2) ºС


при температуре (50±2) ºС



*Стойкость покрытия к катодному отслаиванию, см2, не более:


п. 5.7

через 30 суток, при температуре (23+2) ºС


через 30 суток, при температуре (50+2) ºС


*Испытания проводят не ранее чем через сутки после формирования покрытия.

Похожие продукты

Мастика полимерная защитная «ДЕКОМ»

Мастика «ДЕКОМ» предназначена в качестве защитного слоя (обертки) в конструкции покрытия на основе мастики «ДЕКОМ-АЭРОГАЗ» ТУ 5775-016-32989231-2013 при переизоляции труб, запорной армактуры, соединительных деталей и монтажных узлов газо- и нефтепродуктопроводов диаметром до 1420 мм включительно, с температурой транспортируемого продукта не выше плюс 35 ºС.


Мастика изоляционная битумно-полимерная «ДЕКОМ-АЭРОГАЗ»

Мастика «ДЕКОМ-АЭРОГАЗ» предназначена для защиты от коррозии при проведении в трассовых условиях капитального ремонта изоляционного покрытия (переизоляции) труб, запорной арматуры и соединительных деталей газо- и нефте- продуктопроводов диаметром до 1420 мм включительно, с температурой транспортируемого продукта не выше плюс 35 ºС.
Требуемый уровень показателей к мастике «ДЕКОМ-АЭРОГАЗ»


Реализованные проекты

оборудование, материалы для линейной части трубопроводов

  • Антиповское ЛПУ ООО «Газпром трансгаз Волгоград»

  • Комсомольское ЛПУ МГ ООО «ГтЮгорск»

  • МГ «Ухта-Торжок III» Ду 1400,Синдорскоое ЛПУ МГ ООО «Газпром трансгаз Ухта»

  • Газопровод «У195-1 очередь ГПЗ»

  • Учебно-технический центр ООО «ГЕкатеринбург», г. Челябинск

  • Балашовское ЛПУ МГООО «ГТСаратов»

09.04.2020 15:34:00
Все предприятия Группы компаний Рускомпозит продолжают свою работу.
В соответствии с Указом Президента РФ «О мерах по обеспечению санитарно-эпидемиологического благополучия населения на территории Российской Федерации в связи с распространением новой коронавирусной инфекции (COVID-19)» установленные нерабочие дни с 04 апреля по 30 апреля 2020г. не распространяются на работников непрерывно действующих организаций — АО «Делан»

30.03.2020 18:24:00
Правительственная комиссия по экономической политике под председательством вице-премьера Андрея Белоусова утвердила новый перечень системообразующих организаций российской экономики. В него вошла и Группа компаний РУСКОМПОЗИТ, в составе которой АО «Стеклонит», АО «Делан», ООО «КСИ» и ООО «Стеклонит менеджмент».

18.12.2019 10:41:00
В г. Новокуйбышевск АО «Делан» провел семинар — презентация современных технологий, изоляционных материалов и оборудования, применяемых для защиты от коррозии объектов магистральных газопроводов ПАО «Газпром».

31.10.2019 13:28:00
В ООО «Газпром трансгаз Югорск» на ГКС №11 Ужгородской Комсомольского ЛПУ МГ компания Делан, входящая в ГК РУСКОМПОЗИТ, провела демонстрационное нанесение изоляционных материалов и технологий марки «Canusa – CPS».

На IX Петербургском международном газовом форуме компания «ДЕЛАН», входит в ГК «РУСКОМПОЗИТ», представила собственную экспозицию на стенде «Современные отечественные технологии в газовой отрасли».

23.09.2019 17:49:00
С 1 по 4 октября компания «ДЕЛАН», входит в ГК «РУСКОМПОЗИТ», примет участие в IX Петербургском международном газовом форуме. Экспозиция компании будет представлена на стенде «Современные отечественные технологии в газовой отрасли», павильон G.

На базе производственной площадки в г. Новокуйбышевск, состоялось выездное совещание по вопросу локализации АО «Делан» продукции компании «Canusa CPS» и внедрению современных технологий и материалов для противокоррозионной защиты технологических объектов ПАО «Газпром».

На одной из производственных площадок АО «Делан», входит в Группу компаний РУСКОМПОЗИТ, состоялось производственное совещание. Основная цель – обмен опытом по вопросам эксплуатации оборудования ПКЗ и повышение квалификации специалистов противокоррозионной защиты ООО «Газпром трансгаз Москва».

Приглашаем посетить наш стенд на выставке

Компания Делан, входящая в холдинг РУСКОМПОЗИТ, выступит экспонентом крупнейшей нефтегазовой выставки республики Азербайджан, которая пройдет с 29 мая по 1 июня 2018 года, в Экспоцентре г. Баку. Выставка является самым масштабным международным бизнес-событием региона и ежегодно привлекает внимание большого числа профессионалов нефтегазового рынка.

7 декабря 2017 г. состоялся VI Конгресс предприятий наноиндустрии, на котором АО «Делан» наградили очередным Знаком «Российская нанотехнологическая продукция».

Осенью этого года прошел ряд испытаний антикоррозийных покрытий производства канадской фирмы CANUSA, официальным представителем и партнером которой в России является АО «Делан». В демонстрации материалов на технологичность прияли участие следующие компании: АО «Делан» (ГК «РУСКОМПОЗИТ») – как поставщик защитных материалов; ООО «Газпром трансгаз Волгоград», ООО «Газпром трансгаз Екатеринбург» и АО «Загорский трубный завод» — как заказчики антикоррозийных покрытий.

«Газпром Трансгаз Томск» отметил АО «Делан» благодарственным письмом за активное участие в проведении смотра-конкурса профессионального мастерства на звание «Лучший специалист противокоррозионной защиты ПО «Газпром».

Ориентация перехода от закупки услуг подрядчиков на оказание ремонтных работ трубопроводов вновь вернулась к решению проблем собственными силами компаний. В первую очередь, это связано с защитой объектов повышенной опасности и с повышенным контролем качества производимых работ.

С 3 по 6 октября 2017 в конгрессно-выставочном центре ЭКСПОФОРУМ, Санкт-Петербург, состоится VII Петербургский Международный Газовый Форум (ПМГФ–2017). На объединенном выставочном стенде СРО «СОПКОР» лидер по производству изоляционных материалов АО «ДЕЛАН» представит свою продукцию.

Письмом от 19 мая 2017 года №03/08/2-4240 ПАО «Газпром» рекомендовано при проектировании и организации работ на объектах газотранспортной сети использовать покрытия и материалы для противокоррозионной защиты производства АО «Делан».

ГК РУСКОМПОЗИТ приняла участие в двухдневном совещании, посвященномитогам и перспективам деятельности по эксплуатации линейной части магистральных газопроводов газотранспортных обществ ПАО «Газпром», проходившем на базе ООО «Газпром трансгаз Ставрополь».

На базе Челябинского отделения ИТЦ ООО «Газпром трансгаз Екатеринбург» российская компания Делан провела испытаниятехнологии нанесения защитного антикоррозионного покрытия Canusa WrapidBond при переизоляции локальных участков трубопроводов и участков газопроводов на переходах «земля-воздух».

Локализация производства зарекомендовавших себя на мировом рынке решений в России –путь к технологической независимости и повышению экономической эффективности, – считают в российской компании «Делан», производящей материалы для защиты газо- и нефтепроводов от коррозии. В середине лета 2016 года «Делан» и ведущий мировой разработчик, производитель и интегратор антикоррозионных решений Canusa-CPSподписали соглашение об организации совместного производства.

Реструктуризация бизнеса ГК «РУСКОМПОЗИТ» призвана повысить гибкость и эффективность работы и обеспечить выходы на новые рынки.

Реструктуризация бизнеса Группы компаний «РУСКОМПОЗИТ» продолжается. Летом этого года сообщалось, что ряд предприятий, ранее входивших в число активов группы компаний, получат автономность управления, а уполномоченный орган управления в виде УК «Рускомпозит» будет расформирован.

ПАО «Газпром» интегрировала систему «Антиконтрафакт» в дочерние общества, оператором системы стала АО «Газпром СтройТЭК Салават». Система предназначена для своевременного предупреждения заказчика о появлении на объектах газотранспортного предприятия контрафактной или некачественной продукции и получении о ней полной информации.

Патенты и свидетельства

Термостойкая битумно-полимерная грунтовка «Деком-ГАЗ» для антикоррозийного покрытия — АО Делан


  • Безналичный расчет


  • Самовывоз
  • Собственная логистика
  • Транспортная компания

ТУ 2313-011-32989231-2013

газо-, нефте- продуктопроводов диаметром до 1420 мм включительно, с температурой транспортируемого продукта не выше 50 ºС.

Применяется в следующих конструкциях битумно-полимерных антикоррозионных покрытий:

• на основе термостойкого рулонного армированного мастичного материала «ДЕКОМ-РАМ» ТУ 5774-015-32989231-2013;

• на основе мастики изоляционной битумно-полимерной «ДЕКОМ-АЭРОГАЗ» ТУ 5775-016-32989231-2013;

• на основе мастики битумно-полимерной изоляционной «ТРАНСКОР-ГАЗ» ТУ 5775-004-32989231-2015;

• на основе рулонного мастичного армированного материала «РАМ»

ТУ 5774-008-32989231-2016.

Требуемый уровень показателей к грунтовки «ДЕКОМ-ГАЗ»

Наименование показателей


Метод контроля по ТУ


Внешний вид

Цвет — черный. Отсутствие комков, сгустков



Вязкость по ВЗ-4, при т-ре (23+2) ºС




Массовая доля нелетучих веществ, %, не менее


п. 5.4


*Адгезионная прочность конструкции покрытия (сталь – грунтовка — мастика, армированная стеклосеткой — защитная обертка) методом отслаивания (под углом 900 v=100 мм/мин), Н/см, не менее:



при температуре (23+2) ºС


при температуре (50+2) ºС



*Адгезионная стойкость конструкции покрытия (сталь – грунтовка — мастика, армированная стеклосеткой — защитная обертка) при сдвиге

(v=50 мм/мин), МПа, не менее:



при температуре (23+2) ºС


при температуре (50+2) ºС



*Стойкость покрытия к катодному отслаиванию, см2, не более:



     через 30 суток, при т-ре (23+2) ºС


     через 30 суток, при т-ре (50+2) ºС


*Испытания проводят не ранее чем через сутки после формирования покрытия.

Похожие продукты

Грунтовка термостойкая битумно-полимерная «Деком-ИНГ»

Предназначенных для проведения переизоляции в трассовых условиях при ремонте труб, нефте- газопродуктопроводов диаметром до 1420 мм включительно, с температурой транспортируемого продукта не выше 50 ºС.
Требуемый уровень показателей к грунтовки «ДЕКОМ-ИНГ».


Мастика полимерная защитная «ДЕКОМ»

Мастика «ДЕКОМ» предназначена в качестве защитного слоя (обертки) в конструкции покрытия на основе мастики «ДЕКОМ-АЭРОГАЗ» ТУ 5775-016-32989231-2013 при переизоляции труб, запорной армактуры, соединительных деталей и монтажных узлов газо- и нефтепродуктопроводов диаметром до 1420 мм включительно, с температурой транспортируемого продукта не выше плюс 35 ºС.


Реализованные проекты

Грунтовка Транскор-Газ


ТУ 5775-005-32989231-2010

     Грунтовка (праймер) «Транскор-Газ» предназначен для нанесения под битумную мастику «Транскор-Газ» 5775-005-32989231-2010 конструкции №12 по ГОСТ Р 51164-98 для переизоляции при капитальном ремонте труб газонефтепродуктопроводов диаметром до 1420 мм с температурой используемого продукта не выше + 35 °С.


     По внешнему виду грунтовка должна представлять собой сиропообразную жидкость без сгустков и комков.

     Технические характеристики грунтовки должны соответствовать нормам, приведенным в таблице.






Вязкость по ВЗ-4 при +20 °С, сек


Сухой остаток, %, не менее


Сухой остаток концентрата, %, не менее


Адгезия мастик к загрунтованной поверхности, 1 сутки, _20°С Мпа, не менее


Стойкость к катодному отслаиванию покрытий, 30 суток, +20 °С, не более



     Грунтовка «Транскор-Газ» состоит из синтетического каучука, нефтяного битума, ингибитора коррозии, фенолоформальдегидной смолы и бензина.



     Ориентировочный расход грунтовки под битумные покрытия составляет  80-100 г/м2. Грунтовку следует наносить на поверхность трубопровода, очищенную от продуктов коррозии, окалины, грязи, масляных пятен, копоти, пыли, маркировочной краски. Поверхность не должна иметь острых выступов, заусенцев, задиров, брызг  металла, шлака. Не допускается наличие влаги в виде капель, наледи, инея. Поверхность должна быть сухой, характерного серого цвета.

     Грунтовку на поверхность трубы наносят, как правило, специальными изоляционными грунтовочными машинами за один проход. Нанесенный слой должен быть ровным, без пропусков, подтеков, сгустков, пузырей. Для равномерного распределения грунтовки рекомендуется устанавливать на изоляционную машину  вращающееся полотенце.

    Температура грунтовки при нанесении должна быть в пределах  от +10 до +30  °С. В зимнее время для поддержания грунтовки в указанном интервале температуры необходимо применять беспламенный   ее подогрев.

когда применять, нормы расхода рабочего раствора

Рубрика: Пестициды
На чтение: 6 мин ·

3 225

Обширное семейство противогрибковых средств, применяемых в садоводстве, делят на две группы. Первая обладает только контактным действием, при котором на поверхности растения образуется прочная клейкая плёнка. Она, с одной стороны, позволяет растению дышать, а с другой – служит непреодолимым барьером для спор патогенных грибков. Фунгицид Делан, применяемый в противодействии грибкам в садах с фруктовыми деревьями и на виноградниках, относится именно к этой группе.

делан фунгицид

Вторая группа — это в фунгициды более разнообразного действия. У них контактные свойства дополнены системными. Это означает, что в такие противогрибковые средства входят двухкомпонентные вещества, и второй включенный в фунгицид состав действует уже на внутриклеточном уровне, внедряясь в ткань растения и расходясь по всему его организму, от макушки до корней. Кожица листвы и стеблей препятствием для этого внедрения не является. Никак не влияя на вегетацию, второй компонент превращает в яд для грибков все клетки обработанной таким фунгицидом культуры, это никак не сказывается на пищевой безопасности и вкусе плодов.

Читайте также: Лучший период для обработки участка Актарой.

Приходится чем-то поступаться: или эффективностью одного из компонентов, или безопасностью препарата (имея в виду его токсичность), и каким другим свойствами. Простота формулы Делана предполагает его эффективность при умеренной цене.

«Аристократ» среди фунгицидов

Да, системного действия у фунгицида Делан нет. Только контактное, поверхностное. Однако это не мешает садоводам год за годом приобретать именно его. И давайте разбираться – почему.

Делан не применяют для спасения урожая от грибковых инфекций у овощей на огородах.

Он предназначен только для спасения от них винограда, яблонь, груш, персиковых и абрикосовых посадок, айвы. То есть сугубо фруктовых культур.

Познакомимся с составом, механизмом действия и и способами обработки Деланом, заодно узнав о мерах предохранения.

70% состава Делана – действующее вещество дитианон. Остальное представляет собой наполнители, ПВА, загустители прочие сопутствующие компоненты. Для промышленных целей, на виноградниках с площадью в десятки сотни гектар, есть пакеты в 1 и 5 килограммов. Для небольших садовых участков обычно покупают пакетики, расфасованные по 5 граммов – вполне достаточная доза для обработки отдельных растений на стандартных 6 сотках. Расфасован в виде гранул, хорошо растворимых в воде.

На споры патогенных грибов Делан действует независимо от стадии х развития. Не важно, ещё спящие они или пошли в рост, эти споры после обработкой фунгицидом будут гарантированно уничтожены.

Средство не разлагается при низких температурах, не боится осадков – после высыхания на листьях образовавшаяся плёнка водой больше не растворяется.

Delan WG

Против чего

Применяется против следующих грибковых инфекций:

  • Дырчатая пятнистость (клястероспориоз).
  • Все виды парши.
  • Фитофтороз, или бурая гниль плодов.
  • Милдью, ложная мучнистая роса.
  • Монилиоз.
  • Ржавчина.
  • Лиственная курчавость.

Дитианон, являющийся фунгицидной основой препарата, попадает на листья растений и образует вместе с другими веществами-наполнителями Делана прочную, не смываемую водой после высыхания, плёнку. На неё также не действуют щёлочи кислоты. Воздействие на споры грибков контактное, непосредственно на клеточную основу патогена.

Преимущества Делана

Резистентность к препарату у грибов возможна, только если Делан применяли год за годом, без перерыва, на одном и том же месте. Чтобы воспрепятствовать привыканию к препарату, достаточно один раз между обработкам этим средством применить другой фунгицид – из семейства контактных или системно-контактных. Это вызовет сбой в начавшемся формироваться механизме резистенции, и Деланом можно будет пользоваться и дальше.

Если объединить положительные качества препарата в один список, то получится следующее:

  1. Длительная сохранность действия на обработанных поверхностях
  2. Срок действия защиты от микозов до 4 недель
  3. Экономичность
  4. Токсических соединений в плодах не образует, товарные качества урожая не страдают.
  5. Класс опасности для человека – 4-й. Для насекомых и птиц – третий.
  6. Удобство и простота применения.

инструкция по применению Делана

Когда применять фунгицид Делан

Лучше всего – ранней весной, в период пробуждения деревьев и виноградной лозы от зимней спячки, когда воздействие препарата будет в основном профилактическим. Впрочем, и в лечебных целях фунгицид Делан применяют тоже – только зачем доводить дело до болезни, если тем же средством её можно предупредить?

Но если заболевание уже случилось, заявленные в аннотации к препарату 28 дней действия руководством к срокам последующих обработок не будут – это только для профилактических целей. При болезненном состоянии культур, если заражение уже произошло, нужно ориентироваться на срок от 5 до 15 дней, в зависимости от погодных условий. В дождливое лето обработки проводят ещё чаще, раз в 5-10 дней.

Как готовить рабочий раствор

Учитывая, что разведённый в воде препарат не хранится, растворы для обработки готовят непосредственно перед нею. На 8-литровое ведро воды растворяют два 5-граммовых пакетика фунгицида, тщательно размешивают. Бак опрыскивателя должен быть предварительно хорошо промытым, с полной или частичной разборкой устройства, если до этого в нём были растворы других препаратов.

Гранулы препарата хорошо растворяются при комнатной температуре.

Нормы расхода рабочего раствора

На одно фруктовое дерево расходуемого разведённого препарата понадобится от 2 до 3 литров. Деревья или лозу предварительно прореживают, отсекая «волчки» и те ветви, которые будут перекрывать в другим солнечный свет, а также способствовать душной, застойной атмосфере внутри кроны.

Во время применения против милдью на виноградных лозах плантации раствором Делана опрыскивают 6-7 раз за сезон, исключая период цветения лозы. На 1 м.кв посадок расход составит 80-100 мл.

Для персиковых и абрикосовых деревьев на 8-10 литров воды разводят три 5-граммовых пакетика. Первая обработка опрыскиванием делается ещё в период набухания лиственных плодовых почек. Последующие – с интервалом в 10-14 дней. Расход рабочего раствора на 1 кв. метр составляет от 100 до 120 мл .

От парши на яблоне, груше, айве делают раствор по инструкции на этикетке препарата и обрабатывают каждое дерево 5-6 раз за сезон вегетации. Первое опрыскивание производят, когда только начинают распускаться листья. В пересчёте на квадратные метры это составит около 100 мл раствора/м. кв.

урожай винограда


Для чередования средств защиты от грибков или смешивания можно воспользоваться таким списком фунгицидов:

  • Би-28 Новый.
  • Строби.
  • Полирам.
  • Кумулус.
  • Фастак.

Чередование с этими противогрибковыми препаратами или их смешивание с Диланом могут понадобиться для предотвращения привыкаемости патогенов.

Меры безопасности

Обычные для веществ 4 класса опасности, то есть простая марлевая повязка, закрывающая рот и нос, очки, предохраняющие от попадания капель на кожу. Вещество не ядовито, но определённое негативное воздействие (хотя бы в виде раздражения кожи слизистых) оказать может.

При попадании раствора в глаза, в нос или на кожу промыть поражённые места проточной водой. Если случайно сделали глотов, перепутав с водой – немедленно запить литром-двумя тёплой воды и вызвать рвоту.

Одежду после опрыскивания сада выстирать с резко-щелочным (хозяйственным) мылом – щёлочь в любом виде нейтрализует дитианон, основное рабочее вещество Делана.


Делан — недорогой, безопасный для человека и качества плодов препарат с контактным способом воздействия на патогенные грибы. Стойкий к осадкам, не вызывающий привыкания у объектов воздействия, распадающийся в грунте на безопасные составляющие уже через 2-3 недели. Разнообразная по весу упаковка и хорошая растворимость в воде комнатной температуры делает Делан удобным для использования в «полевых» условиях.

Каким минеральным удобрением вы пользовались?

Poll Options are limited because JavaScript is disabled in your browser.

Можно выбрать несколько ответов или вписать свой вариант.

  • Суперфосфат 14%, 1056 голосов

    1056 голосов 14%

    1056 голосов — 14% из всех голосов

  • Карбамид 10%, 725 голосов

    725 голосов 10%

    725 голосов — 10% из всех голосов

  • Нитроаммофоска 8%, 621 голос

    621 голос 8%

    621 голос — 8% из всех голосов

  • фитоспорин*7%, 527 голосов

    527 голосов 7%

    527 голосов — 7% из всех голосов

  • Доломитовая мука 6%, 492 голоса

    492 голоса 6%

    492 голоса — 6% из всех голосов

  • Монофосфат калия 5%, 390 голосов

    390 голосов 5%

    390 голосов — 5% из всех голосов

  • Азофоска*5%, 384 голоса

    384 голоса 5%

    384 голоса — 5% из всех голосов

  • Кальциевая селитра*5%, 356 голосов

    356 голосов 5%

    356 голосов — 5% из всех голосов

  • комплексные минерально витаминные*4%, 331 голос

    331 голос 4%

    331 голос — 4% из всех голосов

  • калимагнезия, карбамид, калий сернокислый, зола*4%, 274 голоса

    274 голоса 4%

    274 голоса — 4% из всех голосов

  • селитра*3%, 262 голоса

    262 голоса 3%

    262 голоса — 3% из всех голосов

  • Аммофоска 3%, 259 голосов

    259 голосов 3%

    259 голосов — 3% из всех голосов

  • Диаммофоска 3%, 255 голосов

    255 голосов 3%

    255 голосов — 3% из всех голосов

  • Посмотреть ответы*3%, 233 голоса

    233 голоса 3%

    233 голоса — 3% из всех голосов

  • Сульфат аммония 3%, 221 голос

    221 голос 3%

    221 голос — 3% из всех голосов

  • селитра калиевая*3%, 190 голосов

    190 голосов 3%

    190 голосов — 3% из всех голосов

  • навоз*2%, 178 голосов

    178 голосов 2%

    178 голосов — 2% из всех голосов

  • аммиачная селитра*2%, 140 голосов

    140 голосов 2%

    140 голосов — 2% из всех голосов

  • Сульфат калия, сульфат магния*1%, 112 голосов

    112 голосов 1%

    112 голосов — 1% из всех голосов

  • только навоз*1%, 106 голосов

    106 голосов 1%

    106 голосов — 1% из всех голосов

  • Хлористый калий 1%, 105 голосов

    105 голосов 1%

    105 голосов — 1% из всех голосов

  • Борофоска*1%, 74 голоса

    74 голоса 1%

    74 голоса — 1% из всех голосов

  • нитрофоска*1%, 54 голоса

    54 голоса 1%

    54 голоса — 1% из всех голосов

  • гумат калия*1%, 47 голосов

    47 голосов 1%

    47 голосов — 1% из всех голосов

  • Безводный аммиак 1%, 39 голосов

    39 голосов 1%

    39 голосов — 1% из всех голосов

  • Моноаммонийфосфат, монокалийфосфат, диаммонийфосфат*1%, 39 голосов

    39 голосов 1%

    39 голосов — 1% из всех голосов

  • Крапивный настой*0%, 27 голосов

    27 голосов

    27 голосов — 0% из всех голосов

  • Осмокот*0%, 26 голосов

    26 голосов

    26 голосов — 0% из всех голосов

  • Только зола*0%, 22 голоса

    22 голоса

    22 голоса — 0% из всех голосов

  • гуми*0%, 14 голосов

    14 голосов

    14 голосов — 0% из всех голосов

  • аммофос*0%, 10 голосов

    10 голосов

    10 голосов — 0% из всех голосов

  • сульфоамофос*0%, 5 голосов

    5 голосов

    5 голосов — 0% из всех голосов

Всего голосов: 7574

Голосовало: 1855

01.04.2019 — 30.11.2022

* — добавлен посетителем


Вы или с вашего IP уже голосовали.

Крепление к газопроводу в слабонесущих грунтах (КГСГ) «ДЕЛАН» контрольно-измерительных пунктов (КИП)

Главная > Продукция Делан > Крепление к газопроводу в слабонесущих грунтах (КГСГ) «ДЕЛАН» контрольно-измерительных пунктов (КИП)


  • Безналичный расчет


  • Самовывоз
  • Собственная логистика
  • Транспортная компания

ТУ 4318-023-32989231-2016

КГСГ «Делан» предназначены для удержания стойки КИП в вертикальном положении в болотистой местности, работающие в атмосферных условиях при рабочих температурах от минус 60ºС до плюс 60ºС.
КГСГ «Делан» выпускаются для стоек тип 1 (треугольного сечения) и тип 2 (квадратного сечения).

Основные габаритные размеры и масса* КГСГ «Делан»

Наименование показателя


Тип 1 (треугольник)

Тип 2 (квадрат)


Габаритные размеры***




-высота изделия, мм



— ширина грани стойки, не менее мм




Толщина стенки стойки, мм, не менее




Ширина хомута, мм, не менее:




для диаметров от 325 до 530 мм



для диаметров от 630 до 1420 мм




Масса * КГСГ (с комплектующими), кг, не более




* Масса укомплектованного КГСГ зависит от диаметра трубопровода.

** Допуск габаритных размеров КГСГ должен составлять не более (± 1) %.

*** Высота и ширина грани изделия может быть изменена по требованию заказчика и уточняется при заказе.

Похожие продукты

Блок совместной защиты БСЗ «Делан»

БСЗ «Делан» предназначен для распределения и регулирования электрического тока в системе электрохимической защиты трубопроводов, в том числе, для  совместной защиты нескольких сооружений подземных коммуникаций, расположенных в непосредственной близости друг от друга, от одного преобразователя.


Контрольно-измерительные пункты параметров электрохимической защиты трубопроводов КП ЭХЗ (СТЕКОН)

Контрольно-измерительные пункты параметров электрохимической защиты трубопроводов КП ЭХЗ (СТЕКОН), предназначенны для контроля (регулировки) параметров электрохимической защиты (ЭХЗ) и обозначения трасс подземных и наземных трубопроводов (газопроводов), работающие в атмосферных условиях при рабочих температурах от минус 60ºС до плюс 60ºС.


Реализованные проекты

Инструмент для проектирования грунтовок

Поиск праймеров, специфичных для вашей ПЦР-матрицы (с использованием Primer3 и BLAST).

Шаблон ПЦР

Параметры грунтовки

Используйте мой собственный прямой праймер (5 ‘-> 3’ на плюсовой нити)

Используйте мой собственный обратный праймер (5 ‘-> 3’ на минусовой нити)

Размер продукта ПЦР

количество праймеров для возврата

Температура плавления грунтовки (Т м )

Выбор экзона / интрона

Последовательность мРНК refseq в качестве входных данных шаблона ПЦР требуется для параметров в разделе

Последовательность мРНК refseq (например, запись последовательности entrez, номер которой начинается с NM_) позволяет программе правильно идентифицировать соответствующую геномную ДНК и, таким образом, находить правильные границы экзона / интрона.

Размах соединения экзонов

Нет предпочтений Праймер должен охватывать соединение экзон-экзон Праймер не может охватывать соединение экзон-экзон

Это контролирует, должен ли праймер охватывать соединение экзона на вашей матрице мРНК. Параметр «Праймер должен охватывать соединение экзон-экзон» указывает программе на возврат по крайней мере одного праймера (в пределах данной пары праймеров), который охватывает соединение экзон-экзон.Это полезно для ограничения амплификации только мРНК. Вы также можете исключить такие праймеры, если хотите амплифицировать мРНК, а также соответствующую геномную ДНК.

Соответствие соединения экзона

Мин. 5 минут матча
Мин 3 ‘матча
Максимум 3 ‘матча

Минимальное и максимальное количество оснований, которые должны отжигаться с экзонами на 5 ‘или 3’ стороне соединения


Это определяет минимальное количество оснований, которое праймер должен отжигать с шаблоном со стороны 5 футов (т.е.е., в направлении начала праймера) или 3′-сторону (т.е. в сторону конца праймера) соединения экзон-экзон. Отжиг к обоим экзонам необходим, поскольку он обеспечивает отжиг к области перехода экзон-экзон, но не к одному экзону отдельно. Обратите внимание, что этот параметр эффективен только в том случае, если вы выбрали «Праймер должен охватывать соединение экзон-экзон» для параметра «Диапазон соединения экзона».

Включение интрона

Диапазон длины интрона

Примечание. Значения параметров, которые отличаются от значений по умолчанию, выделены желтым цветом.
Параметры проверки специфичности пары праймеров
Проверка специфичности

Режим поиска

Автоматическое управление пользователем Нет руководства пользователя

Primer-blast пытается найти специфичные для мишени праймеры, помещая кандидатные праймеры в уникальные области матрицы, которые не похожи на другие мишени.Однако в некоторых случаях праймер-взрыв не может определить, является ли последовательность базы данных предполагаемой целью или нет, поэтому руководство пользователя может быть полезным (например, когда ваш шаблон является полиморфной формой или частичной областью записи в поиске database, или когда база данных, такая как nr, содержит повторяющиеся записи вашего шаблона).

Параметр «Автоматически» запрашивает руководство пользователя только тогда, когда программа не находит достаточного количества уникальных областей шаблона, тогда как параметр «Управляемый пользователем» всегда запрашивает руководство пользователя, если ваш шаблон показывает большое сходство с любыми другими последовательностями базы данных.

База данных

Refseq репрезентативные геномы mRNARefseq Геномы для выбранных организмов (только первичная эталонная сборка) nrRefseq РНК (refseq_rna) Пользовательский

Refseq мРНК:

& nbsp & nbsp & nbsp Это содержит только мРНК из коллекции эталонных последовательностей NCBI

репрезентативных геномов Refseq:

& nbsp & nbsp & nbsp Эта база данных содержит эталонные и репрезентативные геномы NCBI RefSeq по широким группам таксономии, включая эукариоты, бактерии, археи, вирусы и вироиды.Эти геномы являются одними из лучших геномов, доступных в NCBI. Эта база данных содержит минимальную избыточность в представлении генома. Для эукариот включается только один геном для каждого вида (однако, альтернативные локусы эукариотических геномов включены, где это применимо). Для других видов могут быть включены геномы из различных изолятов одного и того же вида. Если применимо, включены геномы митохондрий.

Refseq РНК:

& nbsp & nbsp & nbsp Это содержит все записи РНК из коллекции эталонных последовательностей NCBI

Геномы для


Праймер Дизайн

Люди используют два основных типа грунтовок:

  1. Те, которые усиливают ДНК
  2. Модифицирующие ДНК

Остановимся на первом. Мы будем использовать белок ApoE в качестве модели. Мутации в нем являются сильным генетическим маркером болезни Альцгеймера. Мутации в этом гене происходят в аминокислотах 112 и 158. Наша цель — амплифицировать этот ген и отправить его на секвенирование.Сначала мы создадим праймеры для всего гена, а затем только для важной области.

Сначала найдите последовательность гена, которую вы хотите амплифицировать или изменить. Отличное место для поиска — NCBI (http://www.ncbi.nlm.nih.gov/). Я поискал и нашел последовательность гена мРНК ApoE человека (http://www.ncbi.nlm.nih.gov/nuccore/FJ525876.1). У человека около 3,2 миллиарда оснований ДНК, поэтому наши праймеры, вероятно, должны быть как минимум такими сложными. Поскольку в ДНК 4 основания, сложность равна 4 в степени длины.ДНК из 16 пар оснований встречается примерно 1 из 4,3 миллиарда раз (416). Как правило, длина праймеров составляет от 15 до 21 пары оснований.

Сначала нам нужно понять, как копируется ДНК. ДНК амплифицируется от 3 ’(произносится как Three Prime) до 5’ (произносится Five Prime) конца копируемой нити. Считается, что усиление идет в направлении от 5 до 3 футов.

Прямая грунтовка проста и представляет собой грунтовку, которая располагается на нижней нити со стороны 3 ‘.Обратный праймер более сложен и связывается с верхней цепью на 3 ’стороне.

Давайте сначала рассмотрим пример

Вот наша ДНК:


| | | | | | | | | | | | | | |


давайте сделаем гипотетические праймеры для коротких участков ДНК, каждый из которых состоит из 4 оснований.

Прямые праймеры должны связываться с 3 ’концом нижней нити и поэтому идентичны верхней нити! Это означает, что нашим гипотетическим прямым праймером будет ATGA.Поскольку праймеры читаются и создаются людьми, наш обратный праймер должен быть написан от начала до конца. Это называется «обратным дополнением» верхней пряди. 4 основания, которые связываются с 3 ’верхней нити, представляют собой TCGC. Но помните, что праймер начинается с 3 ’конца, поэтому его следует читать как CGCT. Это обратное дополнение, обратное противоположности верхней пряди.

Глядя на последовательность ApoE, попробуйте сделать прямой и обратный праймеры из 20 оснований.Ответы ниже. http://www.ncbi.nlm.nih.gov/nuccore/FJ525876.1

ApoE forward Primer: cagcggatccttgatgctgc

Обратный праймер ApoE: aagcaccaagttcagggtgt

Мы можем использовать эти праймеры для амплификации ДНК, выделенной у вас самих.Очистите его и отправьте на секвенирование. Но … при секвенировании даже хорошие считывания обычно имеют длину всего около 1000 оснований, а длина гена> 7000 оснований.


не нужно создавать только на конце ДНК, их можно создать где угодно для амплификации ДНК. Теперь давайте расширим область от 112 до 158, чтобы получить более разумную последовательность.

Сначала давайте переведем ДНК, чтобы выяснить, где эти аминокислоты расположены в ДНК, используя http: // web.expasy.org/translate/ Выберите «Включить нуклеотидную последовательность». Теперь давайте поищем строку аминокислот, которые есть в переводе на странице NCBI «VCG». Из-за пробелов на странице перевода нам нужно искать на странице «V C G». Он должен быть в 5-дюймовой раме 2.

Основания в праймере не отображаются в последовательности, и обычно первые несколько оснований зашумлены, поэтому давайте создадим праймер примерно на 50–100 оснований выше VCG.

Я выбрал в качестве своего прямого праймера: gagacgcgggcacggctgtc

Обратный праймер должен располагаться примерно на 50–100 оснований после R158.Итак, давайте найдем ДНК, которая связана с последовательностью VRL, а именно аминокислотами 157–159. Я выбрал такую ​​последовательность: agcgcctggcagtgtaccag

, но это не тот праймер, который нам нужен для создания обратного комплемента.

Дополнение: tcgcggaccgtcacatggtc

Обратное дополнение: ctggtacactgccaggcgct

Прямой и обратный праймеры для амплификации белка ApoE, чтобы увидеть, есть ли у нас мутации, которые являются предиктором болезни Альцгеймера:

Нападающий: gagacgcgggcacggctgtc

Реверс: ctggtacactgccaggcgct

Наконец, вы хотите найти свои праймеры в геноме человека, чтобы убедиться, что последовательность не дублируется где-либо еще (http: // blast.ncbi.nlm.nih.gov/Blast.cgi)

  • Используйте по одной грунтовке за раз
  • Выберите Human Genomic + Transcript для базы данных
  • Нажмите BLAST

Похоже, что наиболее близким является 75% идентичность, что неплохо, но не ужасно.

Праймеры можно заказать в IDT: http://www.idtdna.com/site


Имеет ли значение размер грунтовки? 6.5 Creedmoor small v. Large винтовка с капсюлем латунные сравнения — rifleshooter.com

Имеет ли значение размер грунтовки? 6.5 Creedmoor small v. Large винтовочный капсюль латунные сравнения

Большинство стрелков, включая меня, склонны рассматривать использование маленького винтовочного капсюля в более крупном патроне с центральным патроном как положительный момент. Много лет назад, когда я смотрел свой первый матч по бенчресту и разговаривал с одним из стрелков, он указал на маленький праймер 6PPC как на причину его успеха.Взгляните на другой патрон, который стреляет: 6BR, и снова вы видите небольшой капсюль.

Когда 6.5s начали делать его большими, 6.5 × 47 Lapua часто рассматривалась как превосходящая 6.5 Creedmoor в основном из-за использования небольшого капсюля для винтовки. Высказывались опасения, что небольшой капсюль для винтовки не будет надежно работать в холодную погоду. Это привело к некоторым довольно интересным испытаниям, проведенным стрелками в холодном климате, которые, казалось, показали, что это не так сильно беспокоило, как первоначально думали стрелки.

Некоторые производители латуни, такие как Lapua, начали производить заряд 308 Winchester, в котором использовался небольшой винтовочный капсюль, специально предназначенный для стрелков на дальние дистанции.Когда латунь 6.5 Creedmoor стала более доступной, некоторые производители латуни предложили ее с маленьким винтовочным капсюлем (вместо указанного большого винтовочного капсюля).

Кажется, небольшой капсюль для винтовки — лучший вариант, когда вы заказываете свою латунь 6.5 Creedmoor? Либо это? Я решил посмотреть, как ведут себя патроны 6.5 Creedmoor, когда они стреляют из одного пистолета с использованием разных капсюлей. Чтобы просмотреть спецификации SAAMI для больших и малых капсюлей, щелкните здесь и перейдите на страницу 36.

Обычно это невозможно, поскольку большинство производителей латуни производят латунь Creedmoor 6.5 с большим или малым размером капсюля для винтовки. Starline brass предлагает латунь Creedmoor 6.5 с большим и малым размером грунтовки. Это означает, что мы можем провести прямое сравнение двух разных типов латуни. Некоторые производители предлагают отверстие для вспышки 0,059 ″ (1,5 мм) с их небольшой латунной винтовкой, Starline использует отверстие для вспышки 0,080 дюйма (2 мм) как в большой, так и в малой версиях капсюля для винтовки из своей латуни Creedmoor 6.5.Обратите внимание, что размер отверстия для прошивки не указан в упомянутом выше документе SAAMI.

Всегда интересно сравнивать данные о ручной нагрузке, ведь нужно контролировать так много переменных, что трудно получить надежные данные. Скажем, например, в случае этого теста с латунным гильзой я использовал одинаковую нагрузку для обоих картриджей. Кто-то может возразить, что заряд был оптимизирован для большого или маленького капсюля для винтовки и что он не обязательно показывает преимущества одного перед другим. Для решения этой проблемы я решил испытать 5 разных зарядов одного и того же пороха h5350 с одной и той же пулей (142 SMK).Я зарядил по 10 патронов каждого заряда в каждый тип латуни и произвел две группы по пять выстрелов на 100 ярдов. Я использовал баллистический хронограф MagnetoSpeed ​​V3 с креплением на стволе, чтобы собрать данные для каждой серии из десяти выстрелов. Заряды, снятые из новой латуни, называются «новыми» в таблицах и диаграммах ниже. Это позволило получить больший размер выборки, чем просто 3-5 патронов, и более широкий выбор зарядов. После того, как я провел первый тест, я перезагрузил те же гильзы и повторил тест, на этот раз с гильзами, образованными огнем.Этот второй набор данных обозначен как «1XF» в таблицах и диаграммах ниже.

Прежде чем приступить к съемке, давайте взглянем на заявление об ограничении ответственности ниже:

ВНИМАНИЕ: Указанные нагрузки предназначены только для информационных целей. Они безопасны только в показанной винтовке и могут быть небезопасны в вашей. Проконсультируйтесь с соответствующими руководствами по загрузке, прежде чем создавать свои собственные ручные загрузки. Rifleshooter.com и его авторы не несут никакой ответственности, прямо или косвенно, за безопасность читателей, пытающихся следовать любым инструкциям или выполнять какие-либо из показанных задач, а также за использование или неправильное использование любой информации, содержащейся здесь, на этом веб-сайте.

В качестве тестовой винтовки я выбрал свою любимую винтовку Creedmoor 6.5.

Я построил его из деталей от Brownells, в том числе:

Все детали; ствол, шасси, оптический прицел и спусковой крючок хорошо работают вместе, создавая хорошее стрелковое ружье.

Все началось с шасси AI AX и затем перешло к MDT ESS. В последнее время я много снимал ESS и очень полюбил его! Если вы следили за моим блогом, то заметили, что теперь он оснащен цевьем из углеродного волокна и складным прикладом, мне очень нравится эта винтовка! (Щелкните здесь, чтобы узнать больше о ESS)

Я опубликую отдельный обзор латуни Starline позже, однако позвольте мне сказать, что я довольно впечатлен этим материалом, особенно если учесть цену — в то время, когда я пишу это, Brownells продает его примерно за половину чего стоит Лапуа.Для первой серии раундов я использовал латунь прямо из коробки, без подготовки. Для второй серии «1XF» я пропустил латунь через головку с втулкой Redding полной длины и снял фаску перед загрузкой.

Какие праймеры я использовал и почему?

Легкие, те, которые были у меня и обычно использую. Большая винтовка Wolf и малые капсюли для винтовки CCI 450 magnum. Почему именно те? Анекдотично я вам скажу, что всегда получал самые низкие SD из русских праймеров. Раньше пользовался Тулой до того, как их перестали импортировать.Когда они высохли, я переключился на Wolf. Хотя CCI 450 указан как капсюль для малой винтовки magnum, это мой капсюль для моих 6BR, 6 × 47 Lapua и 6.5 × 47 Lapua. Я добился большого успеха с обоими капсюлями.

Результаты моей первой (новые медные) и второй (1XF) сессий на стрельбище показаны ниже.

Первая новая латунь:

Затем латунь 1XF:

Прошу прощения за цвет мишеней, в реальной жизни они выглядят намного лучше, у меня были проблемы с освещением в помещении.Я разработал эту цель с помощью Rite in the Rain. Он находится на водонепроницаемом ложе с настоящими зелеными, оранжевыми и желтыми точками 1,047 МОА. Цвет обеспечивает отличный контраст, и вы все еще можете видеть свое воздействие на бумаге. Rite in the Rain продает эти мишени, а также бумагу, на которой вы можете распечатать свои собственные мишени. Чтобы узнать больше о Rite in the Rain и их целях, щелкните здесь.

Теперь, когда у нас есть данные, что это значит?

Хороший вопрос.После того, как мы поделились своим набором данных с несколькими стрелками, мы решили, что, вероятно, лучше всего будет представить информацию в виде гистограмм, поэтому я создал графики ниже. На графиках ниже большие патроны винтовочного капсюля окрашены в синий и красный цвет, а малые патроны капсюля — оранжевые и зеленые. Чтобы сравнить данные, собранные за один сеанс, сравните синий цвет с оранжевым и / или красный с зеленым.

Размер праймера по сравнению с размером группы

Этот график сравнивает размер праймера с размером группы, чем меньше, тем лучше (если вам не нравится стрелять из АК). В большинстве случаев (не во всех), я думаю, можно было бы с уверенностью сказать, что маленькие винтовочные капсюли имеют тенденцию производить небольшие группы.

Размер праймера по сравнению со стандартным отклонением

На этом графике сравнивается размер праймера со стандартным отклонением: чем меньше, тем лучше. В большинстве случаев (но не во всех) большие винтовочные капсюли давали более низкие стандартные отклонения, чем маленькие винтовочные капсюли.

Зависимость размера капсюля от начальной скорости пули

На этом графике размер капсюля сравнивается с начальной скоростью пули (фут / сек), чем больше, тем лучше.На самом деле это было довольно неожиданно, поскольку я не ожидал увидеть большой разницы между двумя типами праймеров. Кроме того, по всем направлениям вы заметите повышенную динамику латуни 1XF по сравнению с новой медью. В большинстве случаев (но не во всех) медный капсюль малой винтовки имел более высокие скорости, чем латунь большого капсюля винтовки. Я предполагаю, что повышенная скорость латуни 1XF может быть функцией напряжения шейки, деформационного упрочнения шейки или того и другого.


Вас ничем не удивило? Да, я был немного удивлен тенденцией к тому, что небольшие группы капсюлей винтовки имеют более высокую дульную скорость, чем большие группы капсюлей винтовки.

А как насчет размера выборки? Вы всегда можете иметь больше данных, хотя сравнение размеров выборки из десяти раундов, безусловно, лучше, чем сравнение размеров выборки из пяти, всегда можно сделать больше.

Почему вы не сняли еще один капсюль? Например, почему бы не большая винтовка CCI против маленькой винтовки CCI? Я использовал праймеры, которыми обычно хожу. Если бы я собирался купить латунь 6.5 Creedmoor, я бы использовал именно эти грунтовки. Я подозреваю, что если бы я использовал стандартные праймеры CCI, результаты были бы более несопоставимыми, и я бы больше предпочел небольшой праймер, однако я не могу быть уверен.

Чтобы узнать больше о латуни Starline, щелкните здесь.

Еще больше интересного контента!


Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *